View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11148_high_32 (Length: 233)
Name: NF11148_high_32
Description: NF11148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11148_high_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 16 - 217
Target Start/End: Complemental strand, 45609608 - 45609407
Alignment:
| Q |
16 |
agaaaaaggtttggtctttttcacacacacaaattataaggcatgatcacaaccactgactcactccacctgtttccatcactatcgtccattttaaaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45609608 |
agaaaaaggtttggtctttttcacacacataaattataaggcatgatcacaaccaccgactcactccacctgtttccatcactatcgtccattttaaaat |
45609509 |
T |
 |
| Q |
116 |
tcatcctaagaatttatcaacttgtactaaaccgtcagaaagaccattttgaggaaactcccatgaaccatcacagaaactcgaatacaccctcatgata |
215 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45609508 |
tcatcctaggaatttatcaacttgtactaaaccgtcaaaaagaccattttgaggaaactcccatgaaccatcacagaaactcgaacacaccctcatgata |
45609409 |
T |
 |
| Q |
216 |
ta |
217 |
Q |
| |
|
|| |
|
|
| T |
45609408 |
ta |
45609407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University