View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11148_low_20 (Length: 287)
Name: NF11148_low_20
Description: NF11148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11148_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 18 - 126
Target Start/End: Original strand, 4453742 - 4453850
Alignment:
| Q |
18 |
aagagatgcatatgcattattattaaagacagagatgaccctgacctaggtttaaagattaacattactcttgctcttggacttccttctctttgcaata |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4453742 |
aagaaatgcatatgcattattattaaagacagagatgaccctgacctaggtttaaagattaacattactcttgctcttggacttccttctctttgcaata |
4453841 |
T |
|
| Q |
118 |
caccagata |
126 |
Q |
| |
|
||||||||| |
|
|
| T |
4453842 |
caccagata |
4453850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 192 - 282
Target Start/End: Original strand, 4453916 - 4454006
Alignment:
| Q |
192 |
atcaaagaatttaaatagtgccgtgccatggtacgtacatttcctatataatggtcaacataccctgtcttgaaattgccttcttctctct |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4453916 |
atcaaagaatttaaatagtgccgtgccatggtacgtacatttcctatataatggtcaacataccctgtcttgaaattgccttcttttctct |
4454006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University