View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11148_low_34 (Length: 232)
Name: NF11148_low_34
Description: NF11148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11148_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 16 - 121
Target Start/End: Complemental strand, 8807848 - 8807743
Alignment:
| Q |
16 |
atgaacgcattgttttttctttaacacctaaactcaacaagttctttcactagcactgtcactgccactgctactagcaatgtttaatgttgttgtcctc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8807848 |
atgaacgcattgttttttctttaacacctaaactcaacaagttctttcactagcactgtccctgccactgctactagcaatgtttaatgttgttgtcctc |
8807749 |
T |
 |
| Q |
116 |
atgaaa |
121 |
Q |
| |
|
|||||| |
|
|
| T |
8807748 |
atgaaa |
8807743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 211
Target Start/End: Complemental strand, 8807689 - 8807653
Alignment:
| Q |
175 |
cctccaacaagtgcaaacaaaactagttgaaccacct |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8807689 |
cctccaacaagtgcaaacaaaactagttgaaccacct |
8807653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University