View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11149_high_16 (Length: 243)
Name: NF11149_high_16
Description: NF11149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11149_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 18 - 153
Target Start/End: Complemental strand, 29320822 - 29320687
Alignment:
| Q |
18 |
cctgcataaacaaaaagcatacacagaaaaagaatactttaattagaaaccaattgcatatgtagtggtcttgagtgcttacgatatgctttgaaaaacc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29320822 |
cctgcataaacaaaaagcatacacagaaaaagaatactttaattagaaaccaattgcatatatagtggtcttgagtgcttacgatatactttgaaaaacc |
29320723 |
T |
|
| Q |
118 |
attgtcttgcaagacaagatatgatcaacacttttt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
29320722 |
attgtcttgcaagacaagatatgatcaacacttttt |
29320687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 153 - 234
Target Start/End: Complemental strand, 29320656 - 29320575
Alignment:
| Q |
153 |
tatggtaatattagactgccttttaatcattcatttcatttcaatctttcaatttcaaaaatatcagcttgcactttcatct |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29320656 |
tatggtaatattagactgccttttaatcattcttttcatttcaatctttcaatttcaaaaatatcaacttgcactttcatct |
29320575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University