View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11149_high_9 (Length: 390)
Name: NF11149_high_9
Description: NF11149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11149_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 173 - 379
Target Start/End: Original strand, 11608353 - 11608560
Alignment:
| Q |
173 |
agtcaaataggactgatgtgattttttataatatcactgacgtaaatcatgatagcatattatttt-ttatattaacttgcagggttatggggaccctac |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11608353 |
agtcaaataggactgatgtgattttttataatatcactgacgtaaatcatggtagcatattatttttttatattaacttgcagggttatggggaccctac |
11608452 |
T |
|
| Q |
272 |
actgatgaggtttttgattgctcggtcaatggattcagataaagcagcaaagatgtttgtccaatggcagaaatggagggctactatggtgcctaatgat |
371 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11608453 |
actgatgaggtttttgattgctcgatcaatggattcagataaagcagcaaagatgtttgtccaatggcagaaatggagggctactatggtgcctaatgat |
11608552 |
T |
|
| Q |
372 |
gggttcat |
379 |
Q |
| |
|
|||||||| |
|
|
| T |
11608553 |
gggttcat |
11608560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 11608269 - 11608351
Alignment:
| Q |
19 |
aaattgtagcaactttgtttgaatttggattccccgcggtcaggaatctcatctcatcagtcacagtgaaatatgatagattt |
101 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11608269 |
aaattgtagtaactttgtttgaatttggattccccacggtcaggaatctcatctcatcagtcacagtgaaatatgacagattt |
11608351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University