View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11149_low_16 (Length: 248)
Name: NF11149_low_16
Description: NF11149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11149_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 3744770 - 3744535
Alignment:
| Q |
1 |
gaaattgcctcctcctcagcctaagaagcccagaaccattcaagttcagattgcttgaatttttgttttgaataatgatgtagtgtatgtgtgatggtct |
100 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3744770 |
gaaattgcctcctcctcagcctaagaaacctagaaccattcaggttcaggttgcttgaatttttgttttgaataatgatgtagtgtatgtgtgatggtct |
3744671 |
T |
 |
| Q |
101 |
ttgggggcagaagagtaccaggttgttttttaaggtcgtgcttgtgtgatggtatttggtttgatgtaataaaaattagtaattttgatttgcaatgcag |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3744670 |
ttgggggcagaagagtactaggttgttttttaaggtcgtgcttgtgtgatggtatttggtttgatgtaataaaaattagtaattttgatttgcaatgcag |
3744571 |
T |
 |
| Q |
201 |
ttattctgtttctgtgattgtgattgttcttgttct |
236 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3744570 |
ttattctgtttctgtgattttgattgttcttgttct |
3744535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 59
Target Start/End: Original strand, 4084453 - 4084497
Alignment:
| Q |
15 |
ctcagcctaagaagcccagaaccattcaagttcagattgcttgaa |
59 |
Q |
| |
|
||||||||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
4084453 |
ctcagcctaagaaacccagaactattcaggttcagattgcttgaa |
4084497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University