View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11149_low_17 (Length: 243)

Name: NF11149_low_17
Description: NF11149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11149_low_17
NF11149_low_17
[»] chr1 (2 HSPs)
chr1 (18-153)||(29320687-29320822)
chr1 (153-234)||(29320575-29320656)


Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 18 - 153
Target Start/End: Complemental strand, 29320822 - 29320687
Alignment:
18 cctgcataaacaaaaagcatacacagaaaaagaatactttaattagaaaccaattgcatatgtagtggtcttgagtgcttacgatatgctttgaaaaacc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||    
29320822 cctgcataaacaaaaagcatacacagaaaaagaatactttaattagaaaccaattgcatatatagtggtcttgagtgcttacgatatactttgaaaaacc 29320723  T
118 attgtcttgcaagacaagatatgatcaacacttttt 153  Q
    ||||||||||||||||||||||||||||||||||||    
29320722 attgtcttgcaagacaagatatgatcaacacttttt 29320687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 153 - 234
Target Start/End: Complemental strand, 29320656 - 29320575
Alignment:
153 tatggtaatattagactgccttttaatcattcatttcatttcaatctttcaatttcaaaaatatcagcttgcactttcatct 234  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||    
29320656 tatggtaatattagactgccttttaatcattcttttcatttcaatctttcaatttcaaaaatatcaacttgcactttcatct 29320575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University