View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11149_low_19 (Length: 241)
Name: NF11149_low_19
Description: NF11149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11149_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 8 - 224
Target Start/End: Original strand, 33437961 - 33438177
Alignment:
| Q |
8 |
aggaagattaattttgatcttgtgtgcaatatatatcttcaaaccgtataaaacaatatcaagtagctatatgcataatgtcttttttctatcaaaacct |
107 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33437961 |
aggaagattaattttgatcttgtgtgtaatatatatcttcaaaccgtataaaacaatatcaagtagctatatgcataatgtcttttttctatcaaaacct |
33438060 |
T |
|
| Q |
108 |
atttgctatatgcataattgtgcacgcatttaactcttttttcttcctatcactctcaaataaaaaatttggcttttctcttttgcctttcaattcaacc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33438061 |
atttgctatatgcataattgtgcacgcatttaactcttttttcttcctatcactctcaaataaaaaatttggcttttctcttttgcctttcaattcaacc |
33438160 |
T |
|
| Q |
208 |
cttactagtatgtgttt |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33438161 |
cttactagtatgtgttt |
33438177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University