View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_high_113 (Length: 215)
Name: NF1114_high_113
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_high_113 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 22 - 206
Target Start/End: Original strand, 327840 - 328023
Alignment:
| Q |
22 |
gaagttgtacgaatctctaaaacttttatatcgcggtcacaattgcggttagaataccacaatttagaatttattttttaaagaaattattgttagtann |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
327840 |
gaagttgtacgaatctctaaaacttttatattgctgtcacaattgcggttagaataccacaatttagaattt-ttttttaaagaaattattgttagtatt |
327938 |
T |
 |
| Q |
122 |
nnnnnnnctttcatcaatgtctgatgattaattgtgtaattaactattaatggaaaaattaatggatgaatgaatgcagaataat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
327939 |
tttttttctttcatcaatgtctgatgattaattgtgtaattaactattaatggaatgattaatggatgaatgaatgcagaataat |
328023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University