View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_high_116 (Length: 212)
Name: NF1114_high_116
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_high_116 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 10818625 - 10818727
Alignment:
| Q |
1 |
attgctcggactctttgatctcttagttgtcattgatatttgccacacatgattttcttgatgtgattttttatcattatcagatatatggtgagacccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10818625 |
attgctcggactctttgatctcttagttgtcattgatatttgccacacatgattttcttgatgtgattttttatcattatcagatatatggtgagacccc |
10818724 |
T |
 |
| Q |
101 |
tac |
103 |
Q |
| |
|
||| |
|
|
| T |
10818725 |
tac |
10818727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University