View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_high_118 (Length: 206)
Name: NF1114_high_118
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_high_118 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 19 - 200
Target Start/End: Complemental strand, 328020 - 327840
Alignment:
| Q |
19 |
attctgcattcattcatccattaatttttccattaatagttaattacacaattaatcatcagacattgatgaaagnnnnnnnnntactaacaataatttc |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
328020 |
attctgcattcattcatccattaatcattccattaatagttaattacacaattaatcatcagacattgatgaaagaaaaaaaaatactaacaataatttc |
327921 |
T |
 |
| Q |
119 |
tttaaaaaataaattctaaattgtggtattctaaccgcaattgtgaccgcgatataaaagttttagagattcgtacaacttc |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
327920 |
tttaaaaaa-aaattctaaattgtggtattctaaccgcaattgtgacagcaatataaaagttttagagattcgtacaacttc |
327840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University