View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_high_122 (Length: 204)
Name: NF1114_high_122
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_high_122 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 1522027 - 1522135
Alignment:
| Q |
1 |
atgactaaaccattgttatatatattacctccaaaa-aatccattattatattaggtcattatcccaagactctaaacaccactcgtgagtgttccaata |
99 |
Q |
| |
|
||||||||||||||||||||| |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1522027 |
atgactaaaccattgttatat----tacctctaaaaaaatccattattatattaggtcattatcccaagactctaaacaccactcgtgagtgttccaata |
1522122 |
T |
 |
| Q |
100 |
gacatttacagta |
112 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1522123 |
gacatttacagta |
1522135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University