View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_high_126 (Length: 202)
Name: NF1114_high_126
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_high_126 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 14 - 131
Target Start/End: Complemental strand, 3607757 - 3607640
Alignment:
| Q |
14 |
gagagtatgctgggctggtgaaaataaacaatcagcaaaacaagtaatgaatttgaagttcctacgtctaaccaataataagtggcaattaaaataataa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3607757 |
gagagtatgctgggctggtgaaaataaacaatcagcaaaacaagtaatgaatttgaagttcctacgtctaaccaataataagtggcaattaaaataataa |
3607658 |
T |
|
| Q |
114 |
taatcagaattatctacc |
131 |
Q |
| |
|
|||||| ||| ||||||| |
|
|
| T |
3607657 |
taatcataataatctacc |
3607640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University