View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_high_41 (Length: 383)
Name: NF1114_high_41
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_high_41 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 93 - 129
Target Start/End: Complemental strand, 33269773 - 33269737
Alignment:
| Q |
93 |
tgaacaaagtattaattggatttgttgtgcgctaaaa |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33269773 |
tgaacaaagtattaattggatttgttgtgtgctaaaa |
33269737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University