View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_high_59 (Length: 345)
Name: NF1114_high_59
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_high_59 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 9 - 298
Target Start/End: Original strand, 35069447 - 35069734
Alignment:
| Q |
9 |
ttatgaaaataagctaaaaatatcttcacgaaatgtcgtaaattatcttacaaatgtattctaaaattaacgtagatatttacgtgatgagataagttcg |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
35069447 |
ttattaaaataagctaaaaatatcttcacgagatgtcgtaaattatcttaca--tgtattctaaaattaacgtagatacttacgtgatgagataagtccg |
35069544 |
T |
 |
| Q |
109 |
aataaactctaaataagtttttgcaaagacctcacgattatcccaatgcctcattaatgaaatatcacctcgatggtatgagtttgacctttataacctc |
208 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
35069545 |
aataaactctaaataagcttttgcaaagacctcacgattatcctaatgcctcgttaatgaaatatcacctcggtggcatgagtttgacctttataacctc |
35069644 |
T |
 |
| Q |
209 |
atagtacagagttcaaactttctcagggacgattgaaaaatgatcgataatgtcactttaatttattaataataatttgccccttcccca |
298 |
Q |
| |
|
| || || ||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35069645 |
agaggacggagttcaaactttctcagggacgattgaaaaatgacccataatgtcactttaatttattaataataatttgccccttcccca |
35069734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University