View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1114_high_79 (Length: 290)

Name: NF1114_high_79
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1114_high_79
NF1114_high_79
[»] chr7 (1 HSPs)
chr7 (30-279)||(6324310-6324557)


Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 30 - 279
Target Start/End: Original strand, 6324310 - 6324557
Alignment:
30 tatatatgcggaggaaaatgcttgattagttgatgagaaaaatgcttggggtaggaaatgaaaatatgtggctggaaaatacaaatcaaggctggaatcc 129  Q
    ||||||||||||||||||| |||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6324310 tatatatgcggaggaaaatactt--ttagttgatgagaaaaatgcttggggtaggaaatgaaaatatgtggctggaaaatacaaatcaaggctggaatcc 6324407  T
130 atggctaaacacttcccattttaagtgaagaagaaaatgcgtggaattgggttgaactgggaatacttaattacctgggaattcttaagtttgtgacgca 229  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6324408 atggctaaacacttctcattttaagtgaagaagaaaatgcgtggaattgggttgaactgggaatacttaattacctgggaattcttaagtttgtgacgca 6324507  T
230 agaaatgcgtgacaaaataaagataaaagaaaatgaaaatgtatagtata 279  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
6324508 agaaatgcgtgacaaaataaagataaaagaaaatgaaaatgtatagtata 6324557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University