View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_high_80 (Length: 286)
Name: NF1114_high_80
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_high_80 |
 |  |
|
| [»] scaffold0012 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 7e-58; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 97 - 277
Target Start/End: Original strand, 43731528 - 43731710
Alignment:
| Q |
97 |
cggaggaggaagaatcgatcgttttgctttgggtatatgggaagnnnnnnnnnn--cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43731528 |
cggaggaggaagaatcgatcgttttgctttgggtatatgaaaaaaaaaaaaaaaaacgccgctgccggggatcgaacccgggtcacccgcgtgacaggcg |
43731627 |
T |
 |
| Q |
195 |
ggaatacttaccactatactacaacgactttttgatatcaattttcattcttctaacttgttattctgtacagcttcatctca |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
43731628 |
ggaatacttaccactatactacaacgactttttgatatcaattttcattcttctaacgacttattctgtacagcttcgtctca |
43731710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 151 - 230
Target Start/End: Original strand, 43748330 - 43748409
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactttttgat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43748330 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactttttgat |
43748409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 151 - 230
Target Start/End: Original strand, 9944023 - 9944102
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactttttgat |
230 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9944023 |
cgccgttgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgacttgttgat |
9944102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 151 - 223
Target Start/End: Complemental strand, 18364604 - 18364532
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgact |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18364604 |
cgccgttgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgact |
18364532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 151 - 223
Target Start/End: Complemental strand, 35929317 - 35929245
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgact |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35929317 |
cgccgttgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgact |
35929245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 151 - 222
Target Start/End: Complemental strand, 27547245 - 27547174
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgac |
222 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27547245 |
cgccgttgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgac |
27547174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 81; Significance: 4e-38; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 151 - 239
Target Start/End: Original strand, 27282663 - 27282751
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactttttgatatcaatttt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
27282663 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactttttgatgtctatttt |
27282751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 151 - 223
Target Start/End: Complemental strand, 36047120 - 36047048
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgact |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36047120 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgact |
36047048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 151 - 223
Target Start/End: Complemental strand, 36048351 - 36048279
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgact |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36048351 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgact |
36048279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 151 - 230
Target Start/End: Complemental strand, 44206891 - 44206812
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactttttgat |
230 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44206891 |
cgccgctgccggggatcgaatccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactgtttgat |
44206812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 151 - 230
Target Start/End: Original strand, 20190346 - 20190425
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactttttgat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20190346 |
cgccgctgccggggatcgaacccgggtcacccacgtgacaggcgggaatacttaccactatactacaacgactttttgat |
20190425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 151 - 230
Target Start/End: Complemental strand, 32685055 - 32684976
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactttttgat |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32685055 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactctttgat |
32684976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 151 - 230
Target Start/End: Complemental strand, 8880815 - 8880736
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactttttgat |
230 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8880815 |
cgccgttgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactatttgat |
8880736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 151 - 225
Target Start/End: Original strand, 20200374 - 20200448
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgacttt |
225 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20200374 |
cgccgctgtcggggatcaaacccgggtcacccgcatgacaggcaggaatacttaccactatactacaacgacttt |
20200448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 10)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 151 - 225
Target Start/End: Complemental strand, 31604768 - 31604694
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgacttt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31604768 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgacttt |
31604694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 151 - 230
Target Start/End: Original strand, 27481708 - 27481787
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactttttgat |
230 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27481708 |
cgccgctgccggggatcgaacccggatcacccgcgtgacaggcgggaatacttaccactatactacaacgactgtttgat |
27481787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 151 - 224
Target Start/End: Original strand, 39623993 - 39624066
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
224 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39623993 |
cgccgttgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
39624066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 151 - 224
Target Start/End: Original strand, 41665431 - 41665504
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
224 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41665431 |
cgccgttgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
41665504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 151 - 223
Target Start/End: Original strand, 48394383 - 48394455
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgact |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48394383 |
cgccgttgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgact |
48394455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 151 - 222
Target Start/End: Complemental strand, 52044172 - 52044101
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgac |
222 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52044172 |
cgccgttgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgac |
52044101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 151 - 224
Target Start/End: Original strand, 39918624 - 39918697
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
224 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39918624 |
cgccgttgccggggatcgaacccgggtcacccgtgtgacaggcgggaatacttaccactatactacaacaactt |
39918697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 151 - 224
Target Start/End: Original strand, 47667108 - 47667181
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
224 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47667108 |
cgccgttgccggggatcgaacccgggtcacttgcgtgacaggcgggaatacttaccactatactacaacgactt |
47667181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 151 - 224
Target Start/End: Original strand, 48402436 - 48402509
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
224 |
Q |
| |
|
||||| |||| |||||| ||| | ||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
48402436 |
cgccgttgccagggatcaaactcaggtcacccgcgtgacagacgggaatacttaccactatactacaacaactt |
48402509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 48413993 - 48414040
Alignment:
| Q |
160 |
cggggatcgaacccgggtcacccgcgtgacaggcgggaatacttacca |
207 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
48413993 |
cggggatcaaacccgagtcacccgcgtgacaagcgggaatacttacca |
48414040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 74; Significance: 5e-34; HSPs: 7)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 151 - 224
Target Start/End: Original strand, 28040454 - 28040527
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28040454 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
28040527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 151 - 224
Target Start/End: Complemental strand, 33171195 - 33171122
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33171195 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
33171122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 151 - 224
Target Start/End: Complemental strand, 44206169 - 44206096
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44206169 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
44206096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 151 - 238
Target Start/End: Complemental strand, 31516632 - 31516545
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactttttgatatcaattt |
238 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
31516632 |
cgccgctgccgaggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgacttggtgttatcaattt |
31516545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 151 - 224
Target Start/End: Complemental strand, 23260747 - 23260674
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
224 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23260747 |
cgccgttgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
23260674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 151 - 223
Target Start/End: Original strand, 39796752 - 39796824
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgact |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39796752 |
cgccgttgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgact |
39796824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 151 - 222
Target Start/End: Complemental strand, 38538981 - 38538910
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgac |
222 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38538981 |
cgccgttgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgac |
38538910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 74; Significance: 5e-34; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 151 - 224
Target Start/End: Complemental strand, 5031809 - 5031736
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5031809 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
5031736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 151 - 224
Target Start/End: Complemental strand, 17983331 - 17983258
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17983331 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
17983258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 151 - 224
Target Start/End: Complemental strand, 20607621 - 20607548
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20607621 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
20607548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 151 - 223
Target Start/End: Complemental strand, 5757870 - 5757798
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgact |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5757870 |
cgccgttgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgact |
5757798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 151 - 222
Target Start/End: Original strand, 3820306 - 3820377
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgac |
222 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3820306 |
cgccgttgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgac |
3820377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 151 - 222
Target Start/End: Complemental strand, 41985322 - 41985251
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgac |
222 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41985322 |
cgccgctgccggggattgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgac |
41985251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 151 - 224
Target Start/End: Complemental strand, 20610892 - 20610819
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
20610892 |
cgccgctgccggggatcgaacccgggtcacccgggtgacaagcgggaatacttaccactatactacaacaactt |
20610819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 151 - 219
Target Start/End: Original strand, 6073242 - 6073310
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaac |
219 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6073242 |
cgccgttgccggggatcgaacccgggtcacccgcgtgacaggtgggaatacttaccactatactacaac |
6073310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 151 - 222
Target Start/End: Complemental strand, 41988039 - 41987968
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgac |
222 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41988039 |
cgccgctgccggggatcaaacctgggtcacccgggtgacaggcgggaatacttaccactatactacaacgac |
41987968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 151 - 223
Target Start/End: Original strand, 24267487 - 24267559
Alignment:
| Q |
151 |
cgccgctgccggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgact |
223 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24267487 |
cgccgttgccggggatcgaacccgggtcgtccgcgtgacaggcggaaatacttaccactatactacaacgact |
24267559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 161 - 224
Target Start/End: Complemental strand, 184994 - 184931
Alignment:
| Q |
161 |
ggggatcgaacccgggtcacccgcgtgacaggcgggaatacttaccactatactacaacgactt |
224 |
Q |
| |
|
|||||| |||||||| |||||||| |||||| || ||||||||||||||||||||||| |||| |
|
|
| T |
184994 |
ggggattgaacccggatcacccgcatgacagatggaaatacttaccactatactacaacaactt |
184931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 173 - 205
Target Start/End: Complemental strand, 30899769 - 30899737
Alignment:
| Q |
173 |
cgggtcacccgcgtgacaggcgggaatacttac |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30899769 |
cgggtcacccgcgtgacaggcgggaatacttac |
30899737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University