View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_high_94 (Length: 264)
Name: NF1114_high_94
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_high_94 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 44406920 - 44407171
Alignment:
| Q |
1 |
atctcgttactaatgaaagagatttatgaaaaaatacaaatggagtagtaattttttaactctgacactgacactcgtgtaagatttgtctggtactggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44406920 |
atctcgttactaatgaaagagatttatgaaaaaatacaaatggagtagtaattttttaactctgacactgacactcgtgtaagatttgtctggtactggc |
44407019 |
T |
|
| Q |
101 |
aaacaatactaacatgtatgtattcagggcaaagccatctcttgctggaaaatttaggataggatagttccagtggcattgatgttattttttgctgaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44407020 |
aaacaatactaacatgtatgtattcagggcaaagccatctcttgctggaaaatttaggataggatagttccagtggcattgatgttattttttgctgaat |
44407119 |
T |
|
| Q |
201 |
ttagtggcattttcattttatgattcaaataaaaccctgtgctctctcccta |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44407120 |
ttagtggcattttcattttatgattcaaataaaaccctgtgctctctcccta |
44407171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University