View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_100 (Length: 304)
Name: NF1114_low_100
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_100 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 66 - 304
Target Start/End: Original strand, 35740687 - 35740927
Alignment:
| Q |
66 |
aatattacatggtgagctgatcaatgttgataatcttgtttgacctttttgttgatgatagtcataagggaactaacagttcaaattaattaattgcata |
165 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35740687 |
aatattacatgttgagctgatcaatgttgataatcttgtttgacctttttgttgatgatagtcataagggaactaacagttcaaattaatcaattgcata |
35740786 |
T |
|
| Q |
166 |
tttagatttgcggaggatttgtgaaaatcatagcaccatgattttctcaaacctatcgtgattacaagaatgc--atatatgtgtactcatattagataa |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |||||| || ||||||||||||||| |
|
|
| T |
35740787 |
tttagatttgcggaggatttgtgaaaatcatagcaccatgattttgtcaaacctatcgtaattacaagaatgcatatatatctgcactcatattagataa |
35740886 |
T |
|
| Q |
264 |
tcatgtcaccaaatagagctagagataattggaaaagttca |
304 |
Q |
| |
|
|||| ||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
35740887 |
tcatatcaccaaatagcgctagagataattagaaaagttca |
35740927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 38 - 71
Target Start/End: Original strand, 23701276 - 23701309
Alignment:
| Q |
38 |
tgagatgaagaataagacggcgacaaagaatatt |
71 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
23701276 |
tgagaagaagaataagacggcgacaaagaatatt |
23701309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University