View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_101 (Length: 303)
Name: NF1114_low_101
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_101 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 95 - 221
Target Start/End: Original strand, 46655974 - 46656103
Alignment:
| Q |
95 |
aagaacttcttcaacttgttgcactcaagcaggctacaggaacagat---atcatcaaacttgtcacacatgcagctgatataacagaaataacaagaat |
191 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46655974 |
aagaacttcttcaacttgttgcactcatgcaggctacaggaacagatcatatcatcaaacttgtcacacatgcagctgatataacagaaataacaagaat |
46656073 |
T |
|
| Q |
192 |
attcagctttttgtttagttggttcatctc |
221 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |
|
|
| T |
46656074 |
attcagctttttgtttagttggtttatctc |
46656103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 95 - 200
Target Start/End: Complemental strand, 47103250 - 47103145
Alignment:
| Q |
95 |
aagaacttcttcaacttgttgcactcaagcaggctacaggaacagatatcatcaaacttgtcacacatgcagctgatataacagaaataacaagaatatt |
194 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47103250 |
aagaacttcttcaacttgttgcactcatgcaggctacaggaacagatatcatcaaacttgtcgcacatgcagctgatataacagaaataacaagaatatt |
47103151 |
T |
|
| Q |
195 |
cagctt |
200 |
Q |
| |
|
|||||| |
|
|
| T |
47103150 |
cagctt |
47103145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University