View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_112 (Length: 285)
Name: NF1114_low_112
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_112 |
 |  |
|
| [»] scaffold0393 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 79 - 176
Target Start/End: Original strand, 32340006 - 32340103
Alignment:
| Q |
79 |
attatacttgaaagtgttcagtgtaacttgtgtttggttacactttaacatacctctgttgatggcgggataacgaccacctcaaacttttttgtctg |
176 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
32340006 |
attatacttgaaagtgctctgtgtaacttgtgtttggttacactttaacatacctctattgatggcgggatgacggccaccctaaacttttttgtctg |
32340103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 189
Target Start/End: Complemental strand, 3934398 - 3934364
Alignment:
| Q |
155 |
ccacctcaaacttttttgtctggctccgccactga |
189 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3934398 |
ccaccccaaacttttttgtctggctccgccactga |
3934364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 188
Target Start/End: Complemental strand, 38974776 - 38974743
Alignment:
| Q |
155 |
ccacctcaaacttttttgtctggctccgccactg |
188 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
38974776 |
ccaccccaaacttttttgtctggctccgccactg |
38974743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 137 - 189
Target Start/End: Complemental strand, 22270251 - 22270199
Alignment:
| Q |
137 |
ttgatggcgggataacgaccacctcaaacttttttgtctggctccgccactga |
189 |
Q |
| |
|
||||||||||||||||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
22270251 |
ttgatggcgggataacggccaccccaaacatttttgtctggctccgccactga |
22270199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 188
Target Start/End: Original strand, 3175258 - 3175291
Alignment:
| Q |
155 |
ccacctcaaacttttttgtctggctccgccactg |
188 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
3175258 |
ccaccccaaacttttttgtctggctccgccactg |
3175291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 137 - 189
Target Start/End: Original strand, 2736785 - 2736837
Alignment:
| Q |
137 |
ttgatggcgggataacgaccacctcaaacttttttgtctggctccgccactga |
189 |
Q |
| |
|
||||||||||||| ||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
2736785 |
ttgatggcgggatgacggccaccccaaacatttttgtctggctccgccactga |
2736837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 137 - 189
Target Start/End: Original strand, 40925832 - 40925884
Alignment:
| Q |
137 |
ttgatggcgggataacgaccacctcaaacttttttgtctggctccgccactga |
189 |
Q |
| |
|
||||||||||||| ||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
40925832 |
ttgatggcgggatgacggccaccccaaacatttttgtctggctccgccactga |
40925884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 137 - 188
Target Start/End: Complemental strand, 22126411 - 22126360
Alignment:
| Q |
137 |
ttgatggcgggataacgaccacctcaaacttttttgtctggctccgccactg |
188 |
Q |
| |
|
|||||||||| || ||| ||||| ||||| |||||||||||||||||||||| |
|
|
| T |
22126411 |
ttgatggcggcatgacggccaccccaaacatttttgtctggctccgccactg |
22126360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 189
Target Start/End: Complemental strand, 2337920 - 2337886
Alignment:
| Q |
155 |
ccacctcaaacttttttgtctggctccgccactga |
189 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2337920 |
ccaccccaaacttttttgtctggctccgccactga |
2337886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 137 - 188
Target Start/End: Original strand, 6807385 - 6807436
Alignment:
| Q |
137 |
ttgatggcgggataacgaccacctcaaacttttttgtctggctccgccactg |
188 |
Q |
| |
|
||||||||||||| || ||||| |||||||||||||||||||||||||||| |
|
|
| T |
6807385 |
ttgatggcgggatggcggccaccccaaacttttttgtctggctccgccactg |
6807436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 137 - 190
Target Start/End: Original strand, 8363941 - 8363994
Alignment:
| Q |
137 |
ttgatggcgggataacgaccacctcaaacttttttgtctggctccgccactgat |
190 |
Q |
| |
|
||||||||| ||| || ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8363941 |
ttgatggcgagatggcggccaccccaaacttttttgtctggctccgccactgat |
8363994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 137 - 189
Target Start/End: Original strand, 18887344 - 18887396
Alignment:
| Q |
137 |
ttgatggcgggataacgaccacctcaaacttttttgtctggctccgccactga |
189 |
Q |
| |
|
||||||||||||| ||| ||||| |||| ||||||||||||||||||||||| |
|
|
| T |
18887344 |
ttgatggcgggatgacggccaccccaaatatttttgtctggctccgccactga |
18887396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 137 - 188
Target Start/End: Complemental strand, 38871523 - 38871472
Alignment:
| Q |
137 |
ttgatggcgggataacgaccacctcaaacttttttgtctggctccgccactg |
188 |
Q |
| |
|
||||||||||||| || |||| |||||||||||||||||||||||||||| |
|
|
| T |
38871523 |
ttgatggcgggatggcggccactccaaacttttttgtctggctccgccactg |
38871472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 137 - 188
Target Start/End: Original strand, 38115918 - 38115969
Alignment:
| Q |
137 |
ttgatggcgggataacgaccacctcaaacttttttgtctggctccgccactg |
188 |
Q |
| |
|
||||||||||||| || ||||| |||||||||||||| ||||||||||||| |
|
|
| T |
38115918 |
ttgatggcgggatgccggccaccccaaacttttttgtcgggctccgccactg |
38115969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 193
Target Start/End: Complemental strand, 23217324 - 23217286
Alignment:
| Q |
155 |
ccacctcaaacttttttgtctggctccgccactgatgat |
193 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
23217324 |
ccaccccaaacttttttgtctggctccgccactgctgat |
23217286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 156 - 188
Target Start/End: Original strand, 9816468 - 9816500
Alignment:
| Q |
156 |
cacctcaaacttttttgtctggctccgccactg |
188 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
9816468 |
caccccaaacttttttgtctggctccgccactg |
9816500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 157 - 189
Target Start/End: Original strand, 16401276 - 16401308
Alignment:
| Q |
157 |
acctcaaacttttttgtctggctccgccactga |
189 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
16401276 |
acctcaaacttttttgtctggctccgtcactga |
16401308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 137 - 188
Target Start/End: Original strand, 29947664 - 29947716
Alignment:
| Q |
137 |
ttgatggcgggataacgaccacctcaaactttt-ttgtctggctccgccactg |
188 |
Q |
| |
|
||||||||||||| || ||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
29947664 |
ttgatggcgggatggcggccaccccaaactttttttgtctggctccgccactg |
29947716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 137 - 184
Target Start/End: Original strand, 20727815 - 20727862
Alignment:
| Q |
137 |
ttgatggcgggataacgaccacctcaaacttttttgtctggctccgcc |
184 |
Q |
| |
|
||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
20727815 |
ttgatggcgggatggcggccaccccaaacttttttgtctggctccgcc |
20727862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 188
Target Start/End: Complemental strand, 3288054 - 3288021
Alignment:
| Q |
155 |
ccacctcaaacttttttgtctggctccgccactg |
188 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
3288054 |
ccaccccaaacttttttgtctggctccgccactg |
3288021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0393 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0393
Description:
Target: scaffold0393; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 188
Target Start/End: Complemental strand, 10659 - 10626
Alignment:
| Q |
155 |
ccacctcaaacttttttgtctggctccgccactg |
188 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
10659 |
ccaccccaaacttttttgtctggctccgccactg |
10626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 188
Target Start/End: Original strand, 1669120 - 1669153
Alignment:
| Q |
155 |
ccacctcaaacttttttgtctggctccgccactg |
188 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
1669120 |
ccaccccaaacttttttgtctggctccgccactg |
1669153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 188
Target Start/End: Original strand, 16659914 - 16659947
Alignment:
| Q |
155 |
ccacctcaaacttttttgtctggctccgccactg |
188 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
16659914 |
ccaccccaaacttttttgtctggctccgccactg |
16659947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 137 - 190
Target Start/End: Original strand, 33363877 - 33363930
Alignment:
| Q |
137 |
ttgatggcgggataacgaccacctcaaacttttttgtctggctccgccactgat |
190 |
Q |
| |
|
|||||||||| || ||| ||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
33363877 |
ttgatggcggcatgacggccaccccaaacatttttgtctggctccaccactgat |
33363930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 188
Target Start/End: Complemental strand, 38520330 - 38520297
Alignment:
| Q |
155 |
ccacctcaaacttttttgtctggctccgccactg |
188 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
38520330 |
ccaccccaaacttttttgtctggctccgccactg |
38520297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University