View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_119 (Length: 278)
Name: NF1114_low_119
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_119 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 30 - 265
Target Start/End: Complemental strand, 28992104 - 28991869
Alignment:
| Q |
30 |
taaggaaccccaaatgtgtgctacttgtgccagagtaagtgttggtaacttttatttgttatggagacttaagattatagggttaaaatggaatattgaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28992104 |
taaggaaccccaaatgtgtgctacttgtgccagagtaagtgttggtaacttttatttgttatggagacttaagattatagggttaaaatggaatattgaa |
28992005 |
T |
 |
| Q |
130 |
agaagaagttcatgttatgattctttcttttatttacaaagctttttcgtgataacaagaaataaccttagagcatcacatacaaacacaacaattacat |
229 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28992004 |
agaagaagttcatgctatgattctttcttttatttataaagctttttcgtgataacaagaaataaccttagagcatcacgtacaaacacaacaattacat |
28991905 |
T |
 |
| Q |
230 |
tataagggatacataattgtttacttacatcacttc |
265 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28991904 |
aataagggatacataattatttacttacatcacttc |
28991869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University