View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1114_low_122 (Length: 277)

Name: NF1114_low_122
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1114_low_122
NF1114_low_122
[»] chr8 (1 HSPs)
chr8 (117-221)||(37134388-37134491)


Alignment Details
Target: chr8 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 117 - 221
Target Start/End: Original strand, 37134388 - 37134491
Alignment:
117 tcttgttatcccattctacatgtgggtgttaatcttttttattattttcaatgtttcctgagtttattgtgtatgcatgtaaaaggtttcgtctgtcact 216  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37134388 tcttgttatcccattctacatgtgggtgttaatctttt-tattattttcaatgtttcctgagtttattgtgtatgcatgtaaaaggtttcgtctgtcact 37134486  T
217 agaat 221  Q
    |||||    
37134487 agaat 37134491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University