View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_127 (Length: 271)
Name: NF1114_low_127
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_127 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 31 - 222
Target Start/End: Original strand, 4108161 - 4108352
Alignment:
| Q |
31 |
gtgagatgaacaacaacgcagttgccacaaaactgcagtcaaaacttaaaccaaagagatgacaggaagagaaagatatatgtaaggtgttgccgtttgt |
130 |
Q |
| |
|
|||||| || ||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4108161 |
gtgagaagagcaataacgcagttgccacagaactgcagtcaaaacttaaaccaaagagatgacaggaagagaaaaatatatgtaaggtgttgccgtttgt |
4108260 |
T |
|
| Q |
131 |
gtgtcgccgccgccgtctttgcctccatccacctctctcttagatctacccagatcaaagaaatattacaacggcggatttcttcagatttc |
222 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4108261 |
gtgtcgccaccaccgtctttgcctccatccacctctctcttatatctacccagatcaaagaaatattacaacggtggatttcttcagatttc |
4108352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 30 - 222
Target Start/End: Original strand, 2279641 - 2279832
Alignment:
| Q |
30 |
agtgagatgaacaacaacgcagttgccacaaaactgcagtcaaaacttaaaccaaagagatgacaggaagagaaagatatatgtaaggtgttgccgtttg |
129 |
Q |
| |
|
||||||| || ||||||| ||||||||||| |||||||||||||||||||||||||||||| | |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2279641 |
agtgagaagagcaacaacacagttgccacagaactgcagtcaaaacttaaaccaaagagataataggaagagaaagatatctgtaaggtgttgccgtttg |
2279740 |
T |
|
| Q |
130 |
tgtgtcgccgccgccgtctttgcctccatccacctctctcttagatctacccagatcaaagaaatattacaacggcggatttcttcagatttc |
222 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2279741 |
tgtgtcgccgccaccgtctttgcctccatccacctctctc-tagatatacccagatcaaagaaatattacaacgacggatttcttcagatttc |
2279832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 32 - 222
Target Start/End: Complemental strand, 27948889 - 27948711
Alignment:
| Q |
32 |
tgagatgaacaacaacgcagttgccacaaaactgcagtcaaaacttaaaccaaagagatgacaggaagagaaagatatatgtaaggtgttgccgtttgtg |
131 |
Q |
| |
|
||||| || ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
27948889 |
tgagaagagcaacaacgcagttgccacagaactgcagtcaaaacttaaaccaaagagatgacaggaagagaaagatatttgtaaggtgttgccatttgtg |
27948790 |
T |
|
| Q |
132 |
tgtcgccgccgccgtctttgcctccatccacctctctcttagatctacccagatcaaagaaatattacaacggcggatttcttcagatttc |
222 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27948789 |
tgtcgcc------------gcctccatccacctctctcttagatctactcagatcaaagaaatattacaacggcggatttcttcagatttc |
27948711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 144 - 182
Target Start/End: Original strand, 53732065 - 53732103
Alignment:
| Q |
144 |
cgtctttgcctccatccacctctctcttagatctaccca |
182 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
53732065 |
cgtctttgcctccctccacctctctcttagatctaccca |
53732103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University