View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_129 (Length: 269)
Name: NF1114_low_129
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_129 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 5 - 262
Target Start/End: Original strand, 2018814 - 2019071
Alignment:
| Q |
5 |
aatgttactttcaaagatggctcttcctatatcaattttccattactcaaatccctaaatttgaacgacgtcgtctttggaaaccgtgctaacatgttgg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
2018814 |
aatgttactttcaaagatggctcttcctatatcaattttccattactcaaatcccttaatttgaacgacgtcgtctttggaaatcgtgctaacatgtttg |
2018913 |
T |
|
| Q |
105 |
acnnnnnnngcggatgtcccaatgttgaagatgtagaagtgacttcactatcaatagttaatagtcgcattcctcagccaccagaagagggggttgaagc |
204 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2018914 |
actttttttgcggatgtcccaatgttgaagatgtagaagtgacatcactatcaatagttaatagtcgcattcctcagccaccagaagagggggttgaagc |
2019013 |
T |
|
| Q |
205 |
cttaccaaagttggtcagagcaaaaatttcagaattatatagcatgttacctttgctt |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2019014 |
cttaccaaagttggtcagagcaaaaatttcagaattacatagcatgttacctttgctt |
2019071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University