View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_132 (Length: 266)
Name: NF1114_low_132
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_132 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 6 - 180
Target Start/End: Complemental strand, 55178838 - 55178664
Alignment:
| Q |
6 |
gtctgttgtacaatgggtaatgaacttaccggatcgctcaacacacaaatataataacaatcgacacagttcatctcaaattgagggccagagctataaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55178838 |
gtctgttgtacaatgggtaatgaacttaccggatcgctcaacacacaaatataataacaatcgacacagttcatctcaaattgagggccagagctataaa |
55178739 |
T |
|
| Q |
106 |
aatgttattagtttcagtagctgcaagtggtttatctttgaggttctcaactcttgcacttgtcaattctcttca |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55178738 |
aatgttattagtttcagtagctgcaagtggtttatctttgaggttctcaactcttgcacttgtcaattctcttca |
55178664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University