View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_135 (Length: 264)
Name: NF1114_low_135
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_135 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 49 - 239
Target Start/End: Complemental strand, 42332494 - 42332316
Alignment:
| Q |
49 |
ggttagatgtttgggtaagaaatttaggttttggggaagaggtggatttgaatgctctcttggaggagacctctttctttctatctgggatcaacttttg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42332494 |
ggttagatgtttgggtaagaaatttaggttttggggaagaggtggatttgaatgctctcttggaggagacctcttt---------tgggatcaacttttg |
42332404 |
T |
 |
| Q |
149 |
ttggaaaatttgatgaagctcattggtggtgtaaccttgactcatgagggagaaaggtggtcttggattaacgactcttccgatcattcat |
239 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||| ||||||||| |
|
|
| T |
42332403 |
ttggaaaaattgatgaagc---ttggtggtgtaaccttgactcctgagggagaaaggtggtcttgggtgaacgactcttccaatcattcat |
42332316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University