View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_136 (Length: 264)
Name: NF1114_low_136
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_136 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 117 - 216
Target Start/End: Complemental strand, 46644020 - 46643921
Alignment:
| Q |
117 |
gttttccttcctttatttttgccgaactgcaagaaaacatcaaataagatgtttttatatttttaataaaatatctttagtttaatctaacttagaaaaa |
216 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46644020 |
gttttccttcctttatttttgcccaactacaagaaaacatcaaataagatgtttttatatttttaataaaatatctttagtttaatctaacttagaaaaa |
46643921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 146 - 201
Target Start/End: Complemental strand, 46641415 - 46641361
Alignment:
| Q |
146 |
caagaaaacatcaaataagatgtttttatatttttaataaaatatctttagtttaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| | || ||||||||| ||||||| |
|
|
| T |
46641415 |
caagaaaacatcaaataagatgtttttacatttct-atcaaatatcttcagtttaa |
46641361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 210 - 241
Target Start/End: Original strand, 32937742 - 32937773
Alignment:
| Q |
210 |
agaaaaaggtgatataacttgtgatattgttg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32937742 |
agaaaaaggtgatataacttgtgatattgttg |
32937773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University