View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1114_low_145 (Length: 252)

Name: NF1114_low_145
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1114_low_145
NF1114_low_145
[»] chr3 (1 HSPs)
chr3 (1-245)||(47508695-47508936)


Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 47508936 - 47508695
Alignment:
1 acaaacttcaatatatcattgtaacattaaagatagccagccatctaactcataaattaacagagaatgctgaatagatcttccggtattgctcatatct 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
47508936 acaaacttcaatatatcattgtaacattaaagatagccagccatctaactcataaattaacagagattgctgaatagatcttccggtattgctcatatct 47508837  T
101 tgttatataattttttctcaaagaactgatcagaagttatcctccgatgaatgttttgagggnnnnnnngcagtaatgcagggggtttgtacaacaataa 200  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||       |||||||||||||||||||||||||||||||    
47508836 tgttatataattttttctcaaagaactgatcagaagttatcttccgatgagtgttttgaggggttttttgcagtaatgcagggggtttgtacaacaataa 47508737  T
201 tctaaattaataatcaagaagaggataaagtagtgattcatctca 245  Q
    |||||||||||| ||   ||||||||||||||||||||| |||||    
47508736 tctaaattaatactc---aagaggataaagtagtgattcttctca 47508695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University