View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_161 (Length: 218)
Name: NF1114_low_161
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_161 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 207
Target Start/End: Original strand, 28100391 - 28100580
Alignment:
| Q |
18 |
attttcatctcaaatgtgattcatttgttttaccagacatgacccactagatgttgttaatactcagttatctgcaaagcataatgcaaactttcaattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28100391 |
attttcatctcaaatgtgattcatttgttttaccagacatgacccactagatgttgttaatactcagttatctgcaaagcataatgcaaactttcaattt |
28100490 |
T |
 |
| Q |
118 |
tatctataactcactttataataagtaagtgtagttaactattcattagtctataatatcacactatcaacagtacgcacctcaggttca |
207 |
Q |
| |
|
||||||||||| ||||||| |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28100491 |
tatctataactaactttatcataaataagcgtagttaactattcattagtctataatatcacactatcaacagtacgcacctcaggttca |
28100580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University