View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1114_low_166 (Length: 212)

Name: NF1114_low_166
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1114_low_166
NF1114_low_166
[»] chr1 (1 HSPs)
chr1 (1-103)||(10818625-10818727)


Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 10818625 - 10818727
Alignment:
1 attgctcggactctttgatctcttagttgtcattgatatttgccacacatgattttcttgatgtgattttttatcattatcagatatatggtgagacccc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10818625 attgctcggactctttgatctcttagttgtcattgatatttgccacacatgattttcttgatgtgattttttatcattatcagatatatggtgagacccc 10818724  T
101 tac 103  Q
    |||    
10818725 tac 10818727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University