View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1114_low_169 (Length: 206)

Name: NF1114_low_169
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1114_low_169
NF1114_low_169
[»] chr4 (1 HSPs)
chr4 (19-200)||(327840-328020)


Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 19 - 200
Target Start/End: Complemental strand, 328020 - 327840
Alignment:
19 attctgcattcattcatccattaatttttccattaatagttaattacacaattaatcatcagacattgatgaaagnnnnnnnnntactaacaataatttc 118  Q
    |||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||    
328020 attctgcattcattcatccattaatcattccattaatagttaattacacaattaatcatcagacattgatgaaagaaaaaaaaatactaacaataatttc 327921  T
119 tttaaaaaataaattctaaattgtggtattctaaccgcaattgtgaccgcgatataaaagttttagagattcgtacaacttc 200  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||    
327920 tttaaaaaa-aaattctaaattgtggtattctaaccgcaattgtgacagcaatataaaagttttagagattcgtacaacttc 327840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University