View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1114_low_176 (Length: 204)

Name: NF1114_low_176
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1114_low_176
NF1114_low_176
[»] chr8 (1 HSPs)
chr8 (1-112)||(1522027-1522135)


Alignment Details
Target: chr8 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 1522027 - 1522135
Alignment:
1 atgactaaaccattgttatatatattacctccaaaa-aatccattattatattaggtcattatcccaagactctaaacaccactcgtgagtgttccaata 99  Q
    |||||||||||||||||||||    |||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1522027 atgactaaaccattgttatat----tacctctaaaaaaatccattattatattaggtcattatcccaagactctaaacaccactcgtgagtgttccaata 1522122  T
100 gacatttacagta 112  Q
    |||||||||||||    
1522123 gacatttacagta 1522135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University