View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_34 (Length: 426)
Name: NF1114_low_34
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 30 - 358
Target Start/End: Complemental strand, 25467394 - 25467066
Alignment:
| Q |
30 |
catcgtttcacagtcgcatcaatggcggttaacgccgatcgcttccatgattcaaaccctaaaacttgcggtgttttaggcggaagaggattcatcggaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| | |
|
|
| T |
25467394 |
catcgtttcacagtcgcatcaatggctgttaacgccgatcgcttccaagattcaaaccctaaaacttgcgttgttttaggcggaagaggattcatcggga |
25467295 |
T |
|
| Q |
130 |
aatcattaggcttacagctcttgaaactcgggaactggatcgtccgaatcgccgattccactcactctctcaaccttcaccactccgaatctctcctcgc |
229 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25467294 |
aatcattagtcttacagctcttgaaactcggaaactggatcgtccgaatcgccgattccactcactctctcaaccttcaccactccgaatctctcctcgc |
25467195 |
T |
|
| Q |
230 |
tgaagctctctcttcttcccgcgcttcttacttccatctcgacctcaccgataaacaccgcatcgccaaaggtaacctttcaatcgacgcgatcttcttt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25467194 |
tgaagctctctcttcttcccgcgcttcttacttccatctcgacctcaccgataaacaccgcatcgccaaaggtaaccgttcaatcgacgcgatcttcttt |
25467095 |
T |
|
| Q |
330 |
cgatcttctttcaattttctaacaatgtc |
358 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25467094 |
cgatcttctttcaattttctaacaatgtc |
25467066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 363 - 416
Target Start/End: Original strand, 30132501 - 30132554
Alignment:
| Q |
363 |
aatatatttcattttccatgcttccattaggcttattcttctaaattcaagcca |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30132501 |
aatatatttcattttccatgcttccattagacttattcttctaaattcaagcca |
30132554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University