View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_62 (Length: 368)
Name: NF1114_low_62
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_62 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 14225416 - 14225635
Alignment:
| Q |
1 |
atgggagagtaaagatggtccaagcaaaggtgaaggattagatgaagggtcagctgtttgccgagttatctctagcacgaccaccacatcactcttaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14225416 |
atgggagagtaaagatggtccaagcaaaggtgaaggattagatgaagggtcagctgtttgccgagttatctctagcacgaccaccacatcactcttaaac |
14225515 |
T |
 |
| Q |
101 |
ctctcactattcgagctgtttgactgtgctggttta-ttttttatcataacctgatacgtatcataagatttggattttcaagagcattgcataccaaaa |
199 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14225516 |
ctctcaccattcgagctgtttgaccgtgctggtttatttttttatgataacctgataagtatcataagatttggaatttcaagagcattgcataccaaaa |
14225615 |
T |
 |
| Q |
200 |
ttcaaacttgtaatcaagta |
219 |
Q |
| |
|
|||||| ||||||||||||| |
|
|
| T |
14225616 |
ttcaaatttgtaatcaagta |
14225635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University