View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1114_low_68 (Length: 348)

Name: NF1114_low_68
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1114_low_68
NF1114_low_68
[»] chr4 (1 HSPs)
chr4 (30-347)||(39883098-39883415)
[»] chr3 (3 HSPs)
chr3 (91-272)||(40645364-40645543)
chr3 (169-255)||(36826426-36826512)
chr3 (278-344)||(42874636-42874702)
[»] chr7 (1 HSPs)
chr7 (228-299)||(24352009-24352080)
[»] chr5 (1 HSPs)
chr5 (170-298)||(42502497-42502625)


Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 30 - 347
Target Start/End: Original strand, 39883098 - 39883415
Alignment:
30 agctttatgttaatatatcgtgattggtctatatcaatgaaacataaagcttgtgatgcatgagattgtgaagatacgaagtagctttggtcctagggta 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
39883098 agctttatgttaatatatcgtgattggtctatatcaatgaaacataaagcttgtgatgtatgagattgtgaagatacgaagtagctttggtcctagggta 39883197  T
130 attaaagaagaacattggagtaagttctttggtctcgaactttttgtttggattaaatggaacttgaagtgcatggaaattgttaatataccttgagatt 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||    
39883198 attaaagaagaacattggagtaagttctttggtctcgaactttttgtttggattaaatggaacttgacgtgcaaggaaattgttaatataccttgagatt 39883297  T
230 ggtctatattttttggagttatggtgtggattctttggaaggacatgaacatgctcatattttctcatcagtcatatacgggagataaactatggagttc 329  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
39883298 ggtctatattttttggagttatggtgtggactctttggaaggacatgaacatgctcatattttctcatcagtcatatatgggagataaactatggagttc 39883397  T
330 ggttaacaatcacgtcat 347  Q
    ||||||||||||||||||    
39883398 ggttaacaatcacgtcat 39883415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 91 - 272
Target Start/End: Complemental strand, 40645543 - 40645364
Alignment:
91 gagattgtgaagatacgaagtagctttggtcctagggtaattaaagaagaacattggagtaagttctttggtctcgaactttttgtttggattaaatgga 190  Q
    |||||||||| || || ||| ||||||||||  ||||| || ||||||||| |||||||| ||||||   | ||||| ||||||||||||||| ||||||    
40645543 gagattgtgaggacactaaggagctttggtca-agggtcataaaagaagaatattggagttagttctccaggctcgatctttttgtttggattgaatgga 40645445  T
191 acttgaagtgcatggaaattgttaatataccttgagattggtctatattttttggagttatggtgtggattctttggaagga 272  Q
    |||| | ||| | ||| | || |||| || |||| ||||||| ||| || |||||||| |||||||||  ||||| ||||||    
40645444 acttaacgtgtaaggagaatgataattta-cttgggattggtatattttctttggagtcatggtgtgggatctttcgaagga 40645364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 169 - 255
Target Start/End: Original strand, 36826426 - 36826512
Alignment:
169 ctttttgtttggattaaatggaacttgaagtgcatggaaattgttaatataccttgagattggtctatattttttggagttatggtg 255  Q
    ||||||| ||||||| ||| |||||||| ||| | ||| |||| |||| || |||||||||| ||||| || |||||||||||||||    
36826426 ctttttgcttggattgaatagaacttgacgtgtaaggacattggtaatgtaacttgagattgttctatcttctttggagttatggtg 36826512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 42874636 - 42874702
Alignment:
278 acatgctcatattttctcatcagtcatatacgggagataaactatggagttcggttaacaatcacgt 344  Q
    ||||||||||||||||| ||  |||| ||| || |||||||||||||| ||| ||||||||| ||||    
42874636 acatgctcatattttcttattggtcaaatatggaagataaactatggaattcagttaacaataacgt 42874702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 228 - 299
Target Start/End: Complemental strand, 24352080 - 24352009
Alignment:
228 ttggtctatattttttggagttatggtgtggattctttggaaggacatgaacatgctcatattttctcatca 299  Q
    ||||||||| || |||| ||||||||||||| |||||| ||| || | ||||||| ||||||||||||||||    
24352080 ttggtctatcttctttgaagttatggtgtgggttctttagaatgataggaacatgttcatattttctcatca 24352009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 170 - 298
Target Start/End: Complemental strand, 42502625 - 42502497
Alignment:
170 tttttgtttggattaaatggaacttgaagtgcatggaaattgttaatataccttgagattggtctatattttttggagttatggtgtggattctttggaa 269  Q
    |||||||||  ||| |||||||||||| ||| |   | |||| |||| |||||||  |||||| ||| || ||  ||||| |||||||| || |||||||    
42502625 tttttgtttaaattgaatggaacttgacgtgtaattacattggtaatctaccttggaattggtttatcttcttcagagttttggtgtgggttgtttggaa 42502526  T
270 ggacatgaacatgctcatattttctcatc 298  Q
    ||| || || |||||||||||||||||||    
42502525 ggatataaatatgctcatattttctcatc 42502497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University