View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_79 (Length: 337)
Name: NF1114_low_79
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_79 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 117 - 224
Target Start/End: Original strand, 37134388 - 37134494
Alignment:
| Q |
117 |
tcttgttatcccattctacatgtgggtgttaatcttttttattattttcaatgtttcctgagtttattgtgtatgcatgtaaaaggtttcgtctgtcact |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37134388 |
tcttgttatcccattctacatgtgggtgttaatctttt-tattattttcaatgtttcctgagtttattgtgtatgcatgtaaaaggtttcgtctgtcact |
37134486 |
T |
 |
| Q |
217 |
agaattat |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
37134487 |
agaattat |
37134494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University