View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_80 (Length: 336)
Name: NF1114_low_80
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_80 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 43 - 257
Target Start/End: Original strand, 28625990 - 28626204
Alignment:
| Q |
43 |
taaataaaatgctctgcccccagaggatcgaacatgggtcttggctgaatgaatttggacaataaatagcgctattttaaatatataaacgctatctttc |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28625990 |
taaataaaatgctctgcccccagaggatcgaacatgggtcttggctgaatgaatttggacaataaatagcgctattttaaatatataaacgttatctttc |
28626089 |
T |
 |
| Q |
143 |
ataaacgtacgctatctttcataaacttacaatagcctttttaaagcgctatttaaggttgagccataaatagcgtttccatatataaatgagcgccata |
242 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28626090 |
ataaacctacgctatctttcataaacttacgatagcgtttttaaagcgctatttaaggttgagccataaatagcgtttccatatataaatgagcgccata |
28626189 |
T |
 |
| Q |
243 |
aacaatcaatactgg |
257 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
28626190 |
aacaatcaatactgg |
28626204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University