View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_82 (Length: 332)
Name: NF1114_low_82
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_82 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 8e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 97 - 308
Target Start/End: Complemental strand, 50070943 - 50070732
Alignment:
| Q |
97 |
cacctttggcttgagttagattctgttatggtagtccatgccttgaaatccaacactctaattctttggaggttaaggaacaaatggttcaattgttgtc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50070943 |
cacctttggcttgagttagattctgttatggtagtccatgccttgaaatccaacactctaattctttggaggttaaggaacaaatggttcaattgttgtc |
50070844 |
T |
 |
| Q |
197 |
aatggatagattctatgaannnnnnnctctcacatctatagagagggtaactaatgtgttgatgacttagcaaatattggtcttagcccgaatcaattca |
296 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
50070843 |
aatggataggttctatgaatttttttctctcacatctatagagaggataactaatgtgttgatggcttagtaaatattggtcttaccccgaatcaattca |
50070744 |
T |
 |
| Q |
297 |
ctttgtggaatt |
308 |
Q |
| |
|
|||||||||||| |
|
|
| T |
50070743 |
ctttgtggaatt |
50070732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University