View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_86 (Length: 320)
Name: NF1114_low_86
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_86 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 77; Significance: 1e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 73 - 153
Target Start/End: Complemental strand, 44109272 - 44109192
Alignment:
| Q |
73 |
tgtatcgattctaagtgtagatagcacattctcctctttctgtcggaaaatggtttggcaaaacatttagtatctgtggtg |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44109272 |
tgtatcgattctaagtgtagatagcacattctcctctttctgttggaaaatggtttggcaaaacatttagtatctgtggtg |
44109192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 85 - 153
Target Start/End: Complemental strand, 44146781 - 44146713
Alignment:
| Q |
85 |
aagtgtagatagcacattctcctctttctgtcggaaaatggtttggcaaaacatttagtatctgtggtg |
153 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||| ||||| ||||||||||||||||||| |||||||| |
|
|
| T |
44146781 |
aagtgtagatagcacgttcttctctttctgtcgggaaatgctttggcaaaacatttagtacctgtggtg |
44146713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University