View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1114_low_86 (Length: 320)

Name: NF1114_low_86
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1114_low_86
NF1114_low_86
[»] chr2 (2 HSPs)
chr2 (73-153)||(44109192-44109272)
chr2 (85-153)||(44146713-44146781)


Alignment Details
Target: chr2 (Bit Score: 77; Significance: 1e-35; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 73 - 153
Target Start/End: Complemental strand, 44109272 - 44109192
Alignment:
73 tgtatcgattctaagtgtagatagcacattctcctctttctgtcggaaaatggtttggcaaaacatttagtatctgtggtg 153  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
44109272 tgtatcgattctaagtgtagatagcacattctcctctttctgttggaaaatggtttggcaaaacatttagtatctgtggtg 44109192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 85 - 153
Target Start/End: Complemental strand, 44146781 - 44146713
Alignment:
85 aagtgtagatagcacattctcctctttctgtcggaaaatggtttggcaaaacatttagtatctgtggtg 153  Q
    ||||||||||||||| |||| ||||||||||||| ||||| ||||||||||||||||||| ||||||||    
44146781 aagtgtagatagcacgttcttctctttctgtcgggaaatgctttggcaaaacatttagtacctgtggtg 44146713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University