View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_87 (Length: 319)
Name: NF1114_low_87
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_87 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 8e-55; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 211 - 319
Target Start/End: Complemental strand, 3263995 - 3263887
Alignment:
| Q |
211 |
ttaatatggcctaaaaaacagtttaatatttgtatataaaatcacattgaattaatgggctagtttataaaactaaaataactaggaagatgtgttagag |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3263995 |
ttaatatggcctaaaaaacagtttaatatttgtatataaaatcacattgaattaatgggctagtttataaaactaaaataactaggaagatgtgttagag |
3263896 |
T |
|
| Q |
311 |
ttttcttat |
319 |
Q |
| |
|
||||||||| |
|
|
| T |
3263895 |
ttttcttat |
3263887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 76 - 167
Target Start/End: Complemental strand, 3264181 - 3264092
Alignment:
| Q |
76 |
tgagatgaataaaaatgttatgcacaccatattcgtgcaaccacacattacagtttacgaccacagcatctatctagcaagctttaagatcc |
167 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3264181 |
tgagatgaataaaaatgatatgcacaccatattcgtgcaaccacaca--acagtttacgaccacagcatctatctagcaagctttaagatcc |
3264092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 211
Target Start/End: Complemental strand, 3264080 - 3264051
Alignment:
| Q |
182 |
ggtcgaagctttaagatcctcatattggat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3264080 |
ggtcgaagctttaagatcctcatattggat |
3264051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University