View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_92 (Length: 312)
Name: NF1114_low_92
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_92 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 257
Target Start/End: Original strand, 7341127 - 7341376
Alignment:
| Q |
7 |
tccacacccctttctcttctcaaacttcccttatatattccaatcattggaannnnnnnnnnngttatcaattttctccaattattggatcaactaacat |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7341127 |
tccacacctctttctcttctcaaacttcccttatatattccaatcattggaaattttttttt-gttatcaattttctccaattattggatcaactaacat |
7341225 |
T |
 |
| Q |
107 |
gtctttttctctaaccattttattggcctcaccttgatgacatggtttttcttcatttggtaccataacaggaacactttcatccaagtttgaagccgat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7341226 |
gtctttttctctaaccattttattggcctcaccttgatgacatggtttttcttcatttggtaccataacaggaacactttcatccaagtttgaagccgat |
7341325 |
T |
 |
| Q |
207 |
atcttacgattgtgacttttacgcgacacttgccactttgtttccagaccc |
257 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7341326 |
atcttacgattgtgagttttacgcgacacttgccactttgtttccagaccc |
7341376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 56
Target Start/End: Complemental strand, 24805406 - 24805371
Alignment:
| Q |
21 |
tcttctcaaacttcccttatatattccaatcattgg |
56 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24805406 |
tcttctcaaacttccgttatatattccaatcattgg |
24805371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 15 - 58
Target Start/End: Complemental strand, 26765720 - 26765677
Alignment:
| Q |
15 |
cctttctcttctcaaacttcccttatatattccaatcattggaa |
58 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| ||||||||||| |
|
|
| T |
26765720 |
cctttctcttttcaaactttccttatatattcaaatcattggaa |
26765677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University