View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_93 (Length: 311)
Name: NF1114_low_93
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_93 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 100 - 221
Target Start/End: Complemental strand, 32815691 - 32815570
Alignment:
| Q |
100 |
gttgcgttgaatgaaagaatactttcttccatggctgataagaaagatgctgctgctcatccatggcatgacttagagattggtattattattaactaac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32815691 |
gttgcgttgaatgaaagaatactttcttccatggctgataagaaagatgctgctgctcatccatggcatgacttagagattggtattattattaactaac |
32815592 |
T |
|
| Q |
200 |
tcttttttacgtttctttattc |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32815591 |
tcttttttacgtttctttattc |
32815570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University