View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1114_low_95 (Length: 305)
Name: NF1114_low_95
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1114_low_95 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 17 - 276
Target Start/End: Original strand, 48450597 - 48450856
Alignment:
| Q |
17 |
tactatgtccacgtgttccatgtataatagcatcgacctgtttgatgctttttgttgaagagctaattatgtggtctcccctggattaattttgttgaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48450597 |
tactatgtccacgtgttccatgtataatagcaacgacctgtttgatgctttttgttgaagagctaattatgtggtctcccctggattaattttgttgaat |
48450696 |
T |
 |
| Q |
117 |
gacaacttttgctgtcttctatctatgttatgtggttaggaaataagttatgaagcagttcataacgagttacctttgtttgaagatgagacgtttgttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48450697 |
gacaacttttgctgtcttctatctatgttatgtggttaggaaataagttatgaagcagttgataacgaggtacctttgtttgaagatgagacgtttgttg |
48450796 |
T |
 |
| Q |
217 |
taatttagtaacaaaagaactgagcaccatgtaaagttatgacttttgtagtgaaattag |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48450797 |
taatttagtaacaaaagaactgagcaccatgtaaagttatgacttttgtagtgaaattag |
48450856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University