View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11150_high_21 (Length: 281)
Name: NF11150_high_21
Description: NF11150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11150_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 36955991 - 36956187
Alignment:
| Q |
1 |
ttaacgttttcaattatcttcctctgcttcttcttaatcaatcttccaccttccacattcgctatctggcttacgttacccaccaccggtaccaaatgcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36955991 |
ttaacgttttcaattatcttcctctgcttcttcttaatcaatcttccaccttccacattcgctatctggcttacgttacccaccaccggtaccaaatgcg |
36956090 |
T |
 |
| Q |
101 |
tctccgaagaaatccagaataacgtcgtcgttttggctgattatgtcgtcgttcccgatggtcatacccgcagccccactctcgctgtcaaggtaat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36956091 |
tctccgaagaaatccagaataacgtcgtcgttttggctgattatgtcgtcgttcccgatgatcatacccgcagccccactctcgctgtcaaggtaat |
36956187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 91 - 144
Target Start/End: Original strand, 864812 - 864865
Alignment:
| Q |
91 |
accaaatgcgtctccgaagaaatccagaataacgtcgtcgttttggctgattat |
144 |
Q |
| |
|
|||||||| || || |||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
864812 |
accaaatgtgtttctgaagaaattcagaataacgttgttgttttggctgattat |
864865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University