View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11150_high_25 (Length: 266)
Name: NF11150_high_25
Description: NF11150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11150_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 164
Target Start/End: Original strand, 23508972 - 23509143
Alignment:
| Q |
1 |
ttccaactaaatagtaacaatctcttggaatgtcgcatatgtgaacttctaaataatttgtaattaattttg--------tnnnnnnnnnnnttgtaatt |
92 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
23508972 |
ttccaactaaataataacaatctcttggaatgtcgcatatgtgaacttctaaataatttgtaattaattttgtaaaaaaataaataaaaaaattgtaatt |
23509071 |
T |
 |
| Q |
93 |
gttgattgtataattcaaactttagatcaagagaattctgtacctttgaggatgatgaaccacagaggtcac |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||| |||||||| |
|
|
| T |
23509072 |
gttgattgtataattcaaactttagatcaagagaattatgtatctcagaggatgatgaaccacggaggtcac |
23509143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 173 - 242
Target Start/End: Original strand, 23509605 - 23509674
Alignment:
| Q |
173 |
tttttccttaagagatagagaaaggtgactaggtcatgtcagagtcatttccctaaattgtttgattgac |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23509605 |
tttttccttaagagatagagaaaggtgactaggtcatgtcagagtcatttccctaaattgtttgattgac |
23509674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 189 - 237
Target Start/End: Complemental strand, 22783833 - 22783785
Alignment:
| Q |
189 |
agagaaaggtgactaggtcatgtcagagtcatttccctaaattgtttga |
237 |
Q |
| |
|
||||||||| ||||||||||||| ||||| | |||||||||||| |||| |
|
|
| T |
22783833 |
agagaaaggcgactaggtcatgttagagttacttccctaaattgcttga |
22783785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University