View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11150_high_34 (Length: 203)

Name: NF11150_high_34
Description: NF11150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11150_high_34
NF11150_high_34
[»] chr2 (1 HSPs)
chr2 (16-185)||(20043743-20043912)


Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 16 - 185
Target Start/End: Original strand, 20043743 - 20043912
Alignment:
16 agaactacagtgatgaacatatgtggtcactagcaccagaatccacaatccaagaaccaattttggaatgatgtaatgagtaagaaattctagagatacc 115  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20043743 agaacttcagtgatgaacatatgtggtcactagcaccagaatccacaatccaagaaccaattttggaatgatgtaatgagtaagaaattctagagatacc 20043842  T
116 tgaagtggtatgacttgtaacatgtgaaaccaccttacttgtggaaccagaaggagtagccagcagattc 185  Q
    |||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
20043843 tgaattagtatgacttgtaacgtgtgaaaccaccttacttgtggaaccagaaggagtagccagcagattc 20043912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University