View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11150_high_34 (Length: 203)
Name: NF11150_high_34
Description: NF11150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11150_high_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 16 - 185
Target Start/End: Original strand, 20043743 - 20043912
Alignment:
| Q |
16 |
agaactacagtgatgaacatatgtggtcactagcaccagaatccacaatccaagaaccaattttggaatgatgtaatgagtaagaaattctagagatacc |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20043743 |
agaacttcagtgatgaacatatgtggtcactagcaccagaatccacaatccaagaaccaattttggaatgatgtaatgagtaagaaattctagagatacc |
20043842 |
T |
 |
| Q |
116 |
tgaagtggtatgacttgtaacatgtgaaaccaccttacttgtggaaccagaaggagtagccagcagattc |
185 |
Q |
| |
|
|||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20043843 |
tgaattagtatgacttgtaacgtgtgaaaccaccttacttgtggaaccagaaggagtagccagcagattc |
20043912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University