View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11150_low_26 (Length: 269)
Name: NF11150_low_26
Description: NF11150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11150_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 19 - 254
Target Start/End: Complemental strand, 44730110 - 44729875
Alignment:
| Q |
19 |
gacaagaacctagaaatgaacaaaaaatatgtcatggttccaatgaaaccagggaagcctgtcggattaagcgccgaagattgtcgtcgaattctttcga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44730110 |
gacaagaacctagaaatgaacaaaaaatatgtcatggttccaatgaaaccagggaagcctgtcggattaagcgccgaagattgtagtcgaattctttcga |
44730011 |
T |
|
| Q |
119 |
tcgctaactcagctcttaataccaataattatctcatgagctctcaaggctttgttccttggcttgtaaggtttttgaagaaaaagaaagttgaaattgg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44730010 |
tcgctaactcagctcttaataccaataattatctcatgagctctcaaggctttgttccttggcttgtaaggtttttgaagaaaaagaaagttgaaattgg |
44729911 |
T |
|
| Q |
219 |
agaatatgaaactagtttgcagataaatgaagaaga |
254 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
44729910 |
agaagttgaaactagtttgcagataaatgaagaaga |
44729875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University