View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11150_low_33 (Length: 226)
Name: NF11150_low_33
Description: NF11150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11150_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 10 - 208
Target Start/End: Complemental strand, 31704512 - 31704320
Alignment:
| Q |
10 |
agtagcataggcacacatgatcttccaaatgaatttacagtgctgtaacttttcaatgtgtcacatattaaatctctttcatgattatggtatattaagg |
109 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31704512 |
agtaacataagcacacatgatcttccaaatgaatttacagtactgtaacttttcaatgtgtcacatattaaatctctttcatgattatggtatattaagg |
31704413 |
T |
 |
| Q |
110 |
ggttaaagattcatgtagtctgctatcaaattggtgaattttaatcttaatgtggtataatattaatgagtccatgtcaaattctagtttgatttatct |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31704412 |
ggttaaagattcatgtagtctgctatcaaattggtgaattttaatcttaatgtggta------taatgagtccatgtcaaattctagtttgatttatct |
31704320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University