View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11150_low_36 (Length: 217)
Name: NF11150_low_36
Description: NF11150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11150_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 19 - 205
Target Start/End: Original strand, 5179564 - 5179750
Alignment:
| Q |
19 |
tcatgtccatagtagccatagttatgaagaggtgtagggttataataaaagcctgttggaacagcttcagcagcagcagtggaaggagcacctatattca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5179564 |
tcatgtccatagtagccatagttatgaagaggtgtcgggttataataaaagcctgttggaacagcttcagcagcagcagtggaaggagcacctatattca |
5179663 |
T |
 |
| Q |
119 |
tttgtgaagagaaagataaaccaaaaatgttactattttgattgtttaggttaaaggtatcctcaatgttttccatgaacttcatct |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5179664 |
tttgtgaagagaaagataaaccaaaaatgttactattttgattgtttaggttaaaggtatcctcaatattttccatgaacttcatct |
5179750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University